The cannabinoid 1 (CB₁) and cannabinoid 2 (CB₂) receptor agonist, Δ⁹-tetrahydrocannabinol (THC), has been shown to be a broad range inhibitor of cancer in culture and in vivo, and is currently being used in a clinical trial for the treatment of glioblastoma. It has been suggested that other plant-derived cannabinoids, which do not interact efficiently with CB₁ and CB₂ receptors, can modulate the actions of Δ⁹-THC. However, there are conflicting reports as to what extent other cannabinoids can modulate Δ⁹-THC activity, and most importantly, it is not clear whether other cannabinoid compounds can either potentiate or inhibit the actions of Δ⁹-THC. We therefore tested cannabidiol (CBD), the second most abundant plant derived cannabiniod, in combination with Δ⁹-THC. In U251 and SF126 glioblastoma cell lines, Δ⁹-THC and CBD acted synergistically to inhibit cell proliferation. The treatment of glioblastoma cells with both compounds led to significant modulations of the cell cycle and induction of reactive oxygen species (ROS) and apoptosis as well as specific modulations of extracellular signal-regulated kinase (ERK) and caspase activities. These specific changes were not observed with either compound individually, indicating that the signal transduction pathways affected by the combination treatment were unique. Our results suggest that the addition of CBD to Δ⁹-THC may improve the overall effectiveness of Δ⁹-THC in the treatment of glioblastoma in cancer patients.

Cell culture and treatments

The human glioblastoma cell lines used were SF126, U251 and U87. Cell lines were maintained at 37°C and 5% CO₂. In all experiments, the different cell populations were first cultured in RPMI media containing 10% fetal bovine serum (FBS). Glioblastoma cells were then seeded into 96-well plates in 10% FBS and on the first day of treatment the media was replaced with vehicle control or drug in RPMI and 0.1% FBS as previously reported (8). The media with the appropriate compounds were replaced every 24 h. Δ⁹-THC and CBD were obtained from NIH through the National Institute of Drug Abuse.

MTT assay

Assays were performed as previously described (26). % control was calculated as the MTT absorbance of the treated cells/control cells × 100.

Apoptosis analysis

Cells were grown in 6-well culture dishes and treated with the appropriate compounds every 24 h for 3 days. Cells attached to the plate as well as the cells in media were collected, pelleted, washed once with PBS, and processed for labeling with FITC-tagged annexin and propidium iodide (PI) by use of an Apo-Direct apoptosis kit obtained from Phoenix Flow Systems (San Diego, CA). Briefly, the cell pellet was resuspended in 300 µl of the supplied reaction buffer along with 3 µl of both PI and FITC-tagged annexin. After a 15-min incubation period at room temperature, the labeled cells were analyzed by flow cytometry using a FITC detector (FL1) and a PI emission signal detector (FL2). Cell flow cytometry in combination with PI and annexin staining was used to quantify the percentage of cells undergoing apoptosis in control and treatment groups. % control was calculated as annexin positive staining in treated cells/control cells × 100. PI staining was used to distinguish necrotic cells from those undergoing apoptosis.

Cell cycle analysis

U251 cells were grown in Petri dishes (100 mm ×15 mm) and received drug treatments for 2 days. On the third day, the cells were harvested and centrifuged at 1200 rpm for 5 min. The pellet was washed 1X with PBS + 1% BSA, and centrifuged again. The pellet was resuspended in 0.5 ml of 2% paraformaldehyde and fixed overnight at room temperature. The next day the cells were pelleted and resuspended in 0.5 ml 0.3% Triton in PBS and incubated for 5 min at room temperature. The cells were then washed 2 times with PBS + 1% BSA. The cells were finally suspended in PBS (0.1% BSA) with 10 µg/ml Propidium Iodide and 100 µg/ml RNAse. The cells were incubated for 30 min at room temperature before being stored at 4°C. Cell cycle was measured using a FACS Calibur using Cell Quest Pro and Modfit software.

Boyden chamber invasion assay

Assays were performed in modified Boyden Chambers (BD Biosciences, San Diego, CA) as previously described (26). Data were presented as relative invasiveness of the cells through the Matrigel, where the respective controls are set as 100 %.

Reactive oxygen species (ROS) measurements

The production of cellular reactive oxygen species (ROS)/H₂O₂ was measured using 2’–7’Dichlorodihydrofluorescein (DCFH-DA, Sigma Aldrich). DCFH-DA is deacylated intracellularly into a non-fluorescent product, which reacts with intracellular ROS to produce 2’–7’Dichlorofluorescein, which remains trapped inside the cell, and can be measured quantitatively. Cells were plated onto 6-well dishes and received drug treatments for three days. On the third day, 10 mM DCFH-DA was added to the media (MEM with 0.1% FBS) and the cells were incubated with DCFH-DA overnight. The next day, the cells were trypsinized, washed with PBS, and the fluorescent intensity was measured using a FACS and cell quest pro software.

Western analysis

Western analysis was performed as previously described (26). Anti-phospho-JNK, anti-phospho-p38, anti-phospho-ERK1/2 and anti-ERK1/2 were obtained from Millipore. Anti cleaved caspase 3, 7, 9 and PARP were obtained from Cell Signaling, Boston, MA. Antibodies were added according to the manufactures protocol.

Polymerase Chain Reaction

Total cellular RNA was isolated from glioblastoma cancer cells treated with vehicle control or with CBD. Transcripts for p8 and for β-actin were reverse transcribed using SuperscriptII Reverse TranscriptaseII (Gibco-BRL), and polymerase chain reaction performed. The 5′ and 3′ PCR primers were GAAGAGAGGCAGGGAAGACA and CTGCCGTGCGTGTCTATTTA for p8; and GCGGGAAATCGTGCGTGACATT and GATGGAGTTGAAGGTAGTTTCGTG for β-actin. PCR was performed in buffer containing 1 µM of each of the 5′ and 3′ PCR primer and 0.5 U of Taq polymerase using 18 cycles for amplification of p8 and β-actin cDNAs. The cycle conditions were 45 sec denaturation at 94°C, 45 sec annealing at 55°C, and 1 min extension at 72°C.

Pharmacological and statistical analyses

In the proliferation assays, IC₅₀ values with corresponding 95% confidence limits were calculated using non-linear analysis of logged data (GraphPad Prism, San Diego, CA). When just the confidence limits of the IC₅₀ values overlapped significant differences were determined using unpaired Student’s t-test. Significant differences were also determined using one-way ANOVA where suitable. Bonferroni’s multiple comparison post-hoc analyses were conducted when appropriate. P values <0.05 defined statistical significance. Positive and negative aspects of constituent interaction were determined in a 2 × 2 design using two-way ANOVA as described by (27). IC₂₀ and IC₈₀ values were calculated using the equation IC_F = (F/100-F)^1/H • IC₅₀, where F is the fractional response expressed as a percentage, IC_F is the quantity of drug needed to inhibit an F percentage response and H is the hillslope. Treatment groups were divided into 1) no treatment (control), 2) Δ⁹-THC alone, 3) CBD alone, and 4) Δ⁹-THC and CBD combined. Data was analyzed using a two-way ANOVA with an interaction term that was used to test for whether the combination of Δ⁹-THC and CBD differed from the additive effects of each alone (GraphPad Prism, San Diego, CA).

To further test for synergism, the combination index (CI) was calculated where CI< 1, = 1, and >1 indicates synergism, additive effect, and antagonism, respectively (28, 29). Based on the classic isobologram for mutually exclusive effects relative to the end point of measurement, the CI value for × % inhibition is calculated as: CI = (D)₁/(Dx)1 + (D)₂/(Dx)₂ (D)₁ THC; (D)₂ represents CBD; (Dx)₁ and (Dx)₂ are the doses for x% growth that can be obtained using the IC_Fequation described above. (D)₁ and (D)₂ are the concentrations in the combination that also inhibit cell growth by ×% (29).

A cell cycle analysis program was used to estimate the proportions of cells in each of three compartments: G₀/G₁, S, and G₂/G_M. The experiments were conducted on four different dates and there were two replicates for each date. It was noticed that in the control (vehicle) experiments the percentage of cells in each compartment varied significantly from day to day, therefore each treatment compartment percentage estimate was standardized by dividing it by the average percentage for the vehicle on that date. This procedure was carried out for data from each experiment on each day. Multivariate analysis of variance (MANOVA) on the vector of cell cycle compartment standardized ratios (G₀/G₁, S and G₂/G_M) was performed to control the multiple comparison type 1 (false positive) error rate. Since this produced a significant result (at p<0.05), it was concluded that there were differences due to treatments. Standardized ratios for each compartment were then tested separately using univariate one-way ANOVA with treatment as the explanatory factor. These tests were also significant at p<0.05 for each compartment except G₂/G_M. It was concluded that there was evidence for a treatment effect in each of the three cell cycle compartments G₀/G₁, S and G₂/G_M. We then tested the ratios for each treatment within a compartment to determine if they significantly differed from 1.0, indicating a treatment effect for that particular treatment. Finally, we tested for a significant interaction of CBD and Δ⁹-THC, each at their lowest dose by ANOVA with an interaction term. This was carried out after transforming the standardized ratios to logarithms so a test for additive interactions could be performed.

Δ⁹-THC and CBD inhibit the growth of multiple glioblastoma cell lines

The CB₁ and CB₂ receptor agonist, Δ⁹-THC, can inhibit glioblastoma cell proliferation in culture and in vivo and is currently being used in a clinical trial (4). CBD, a cannabinoid constituent with negligible affinity for CB₁ and CB₂receptors, can also inhibit the proliferation of glioblastoma in culture and in vivo(7, 16). SF126, U251 and U87 cells were treated for three days with a range of concentrations of either Δ⁹-THC or CBD. The antiproliferative activity of the compounds was assessed using the MTT assay and the corresponding IC₅₀values were calculated as previously described (26). The IC₅₀ values for Δ⁹-THC in SF126, U251 and U87 cells were 2.5 µM (1.8–3.4), 3.3 µM (2.4–4.6) and 3.3 µM (2.3–4.8), respectively. The IC₅₀ values for CBD in SF126, U251 and U87 cells were 1.2 µM (1.1–1.3), 0.6 µM (0.5–1.0), 0.6 µM (0.5–0.7), respectively. CBD was therefore a more potent inhibitor of cell growth than Δ⁹-THC in the three cell lines studied.

CBD enhances the inhibitory effects of Δ⁹-THC on glioblastoma cell growth

It has been suggested that non-psychoactive cannabinoid constituents can either potentiate or inhibit the actions of Δ⁹-THC (11, 17–19). Therefore, the glioblastoma cell lines that were originally used to test the antiproliferative activity of individual cannabinoids were used to determine the effects of combination treatments. The positive and negative aspects of constituent interaction were tested by analyzing the activity of different combinations of Δ⁹-THC and CBD in a 2 × 2 design (Figure 1). The concentrations used for the treatments were IC₈₀ or IC₂₀ values calculated from the IC₅₀ values as described in the methods. When applied in combination at the predicted IC₈₀concentration, Δ⁹-THC and CBD produced a greater than additive inhibition of cell growth in SF126 and U251 cells. This was not observed in U87 cells (data not shown). In SF126 cells, cell viability in presence of Δ⁹-THC (3.9 µM) was 26 ± 9 %, CBD (1.4 µM) was 40 ± 4 %, and Δ⁹-THC (3.9 µM) + CBD (1.4 µM) was 8 ± 4 % (Figure 1A). In U251 cells, cell viability in presence of Δ⁹-THC (5.4 µM) was 55 ± 3 %, CBD (0.9 µM) was 69 ± 4 % and Δ⁹-THC (5.4 µM) + CBD (0.9 µM) was 2 ± 2 % (Figure 1B). Predicted IC₂₀ concentrations of Δ⁹-THC and CBD that alone produce only minimal effects on cell growth were combined and further tested in a 2 × 2 factorial design in the positive responding cell lines (SF126 and U251). Again, greater than additive effects were observed in SF126 and U251 cells. In SF126 cells, cell viability in presence of Δ⁹-THC (1.6 µM) was 90 ± 4 %, CBD (1.1 µM) was 63 ± 4 %, and Δ⁹-THC (1.6 µM) + CBD (1.1 µM) = 25 ± 6 % (Figure 1C). In U251 cells, cell viability in presence of Δ⁹-THC (1.7 µM) was 71 ± 4 %, CBD (0.4 µM) was 83 ± 5 % and Δ⁹-THC (1.7 µM) + CBD (0.4 µM) was 7 ± 4 % (Figure 1D). In the cell lines demonstrating significant interactions (SF126 and U251 cells), we further tested for synergism using the combination index (CI) described in the methods. As shown in Table 1 supplementary, in both U251 and SF126 cells a synergistic increase in the antiproliferative activity of the cannabinoids was observed. A CI value of <1, 1, and >1 indicates synergism, additivity, and antagonism, respectively (29). Synergistic activity was observed at all the concentration ranges tested in U251 cells, therefore, this cell line was used primarily in the remainder of the experiments.

Figure 1

CBD enhances the inhibitory effects of Δ⁹-THC on glioblastoma cell growth

CBD does not enhance the inhibitory effects of Δ⁹-THC on glioblastoma cell invasiveness

In addition to uncontrolled cell growth, a hallmark of the aggressive phenotype of glioblastoma cells is their ability to migrate away for the primary tumor of origin and invade into neighboring CNS tissue (30). We, therefore, sought to determine whether the addition of CBD to Δ⁹-THC would improve the activity of the compound to inhibit migration and invasion through a reconstituted basement membrane in a Boyden chamber assay (Figure 2). Both Δ⁹-THC and CBD could significantly inhibit the invasiveness of U251 cells. The predicted IC₅₀values for Δ⁹-THC and CBD to inhibit U251 cell invasiveness were 85 nM (49–150) and 126 nM (20–796), respectively. Concentrations of 100 nM Δ⁹-THC and CBD (their approximate EC₅₀ values) were used to test for positive or negative interactions. These concentrations were chosen as compared to the predicted EC₈₀ values to ensure significant increases in cell death would not be produced which could confound the results of the invasion assay, i.e., dead cells will not migrate and invade. Whereas both Δ⁹-THC and CBD were able to inhibit U251 cell invasiveness, CBD did not enhance the activity of Δ⁹-THC when the compounds were combined. In U251 cells, invasiveness in presence of Δ⁹-THC (0.1 µM) was 48 ± 3 %, CBD (0.1 µM) was 72 ± 3 % and Δ⁹-THC (0.1 µM) + CBD (0.1 µM) was 36 ± 3 %. Since Δ⁹-THC and CBD acted synergistically to inhibit glioblastoma cell growth, but not to inhibit cell invasiveness, mechanistic experiments were focused on understanding the reduction in cell viability produced by the combination treatment. The 4:1 ratio of Δ⁹-THC (1.7 µM) and CBD (0.4 µM) (as described above in Figure 1D) was primarily used as the combination treatment for the remainder of the experiments.

Figure 2

Δ⁹-THC in combination with CBD does not produce a greater overall inhibition of glioma invasiveness

The combination treatment of Δ⁹-THC and CBD leads to the modulation of specific mitogen activated kinases (MAPK)

The regulation of ERK, JNK, and p38 MAPK activity plays a critical role in controlling cell growth and apoptosis (31). Modulation of these pathways has been indicated in cannabinoid control of cancer cell growth and survival (9,32–34). We used U251 cells to determine whether modulation of ERK, JNK, and p38 MAPK activity occurred. Treatment with the combination of cannabinoids led to a substantial down-regulation of pERK, but produced no significant change in total ERK (Figure 3A). Additionally, no inhibition of p38 MAPK or JNK activity was observed. When U251 cells were treated with individual concentration of Δ⁹-THC and CBD, instead of the combination, no changes in pERK were observed (Figure 3B). These data demonstrate the modulation of pERK was specific for the combination treatment. Down-regulation of pERK in the presence of the combination treatment was first observed after two days treatment in U251 cells (Figure 3C). The down-regulation of pERK was also observed in SF126 cells using a combination treatment of Δ⁹-THC and CBD (Figure 3D). These data demonstrate the modulation of pERK by the combination treatment of THC and CBD appears to represent a common mechanism shared by different glioblastoma cell lines.

Figure 3

The combination treatment of Δ⁹-THC and CBD specifically inhibits ERK activity

The combination treatment of Δ⁹-THC and CBD inhibits cell cycle and induces apoptosis

Significant reductions in ERK activity have been shown to lead to growth arrest and induction of apoptosis (31). The large reduction in glioblastoma cell viability and ERK activity, observed in the presence of the combination treatment, led us to hypothesize there would be a corresponding modulation of the cell cycle and programmed cell death. Therefore, U251 cells were treated with Δ⁹-THC and CBD alone or with the combination of the two drugs, and cell cycle was analyzed using cell flow cytometry (Table 1). When administered separately, Δ⁹-THC and CBD both produced increases in the population of cells in G₀/G₁ phase, but not in the S and G₂/G_M phase. The combination of Δ⁹-THC and CBD produced a greater than additive increase in the population of cells in G₀/G₁ phase, G₂/G_Mphase and a decrease in cells in S phase.

Table 1

Cannabinoid modulation of cell cycle

In addition to producing cell cycle arrest, the combination treatment may reduce cell viability through induction of apoptosis. We, therefore, measured apoptosis using annexin staining in combination with cell flow cytometery (Figure 4A). There was minor increase in apoptosis produced with 1.7 µM Δ⁹-THC, but it was not found to be significantly different from control (n=7). No increase in apoptosis was observed in the presence of 0.4 µM CBD. However, when Δ⁹-THC and CBD were combined, a greater than additive increase in apoptosis was observed. In a time course analysis studying the induction of apoptosis produced by the combination treatment, we observed only a small increase with the combination treatment after 2 days (Figure 1A and B supplementary), whereas a strong induction of apoptosis was observed by day 3 (Figure 4A).

Figure 4

The effects of the combination treatment are the result of CB₂ activation

The inhibitory effects of the combination treatment are the result of CB₂receptor activation and production of ROS

Depending on the glioblastoma cell line used, studies have linked the inhibitory activity of plant derived cannabinoids to activation of CB₁ and/or CB₂, modulation of MAPKs and induction of cellular stress through increases in ROS and additional stress related proteins, leading to activation of caspases (15, 32,35). We used the measure of apoptosis to investigate mechanisms by which CBD enhanced the activity of Δ⁹-THC.

Apoptosis produced by the combination of Δ⁹-THC and CBD was partially blocked by the CB₂ receptor antagonist, SR144528 (SR2), but almost complete reversal was observed in the presence of the anti-oxidant, α-tocopherol (TCP) (Figure 4B). The cannabinoid receptor antagonists and TCP had no effect on apoptosis on their own at 0.5 µM and 20 µM, respectively (data not shown). As predicted by α-tocopherol blockade, the combination of Δ⁹-THC and CBD produced a significant increase in the formation of ROS as assessed by DCDHF-DA oxidation using FACS analysis (Figure 1C and D supplementary). A small increase in ROS was observed after 1day of treatment with a major induction observed by day 2, preceding the majority of the observed apoptotic cell death.

In order to attempt to match levels of apoptosis produced by the combination treatment, the concentrations of the individual cannabinoids (Δ⁹-THC and CBD) were next increased. The purpose of these experiments was to determine whether the compounds alone recruited similar pathways as compared to the combination of Δ⁹-THC and CBD. When U251 cells were treated with Δ⁹-THC alone, the induction of apoptosis was almost completely blocked by α-tocopherol (TCP) and partially blocked by the CB₂ antagonist SR144528 (SR2) (Figure 4C). However, Δ⁹-THC alone could not produce the level of apoptosis observed with the combination treatment (Figure 4B and C). This finding was not simply an issue of the treatment concentration used since application of Δ⁹-THC up to 5 µM did not produce a greater induction of apoptosis (data not shown). When U251 cells were treated with CBD alone, the induction of apoptosis was blocked by α-tocopherol (TCP) but no reversal was observed with SR144528 (SR2) (Figure 4D). This result was expected since CBD does not interact efficiently with either CB₁ or CB₂ receptors.

The ability of the higher concentrations of Δ⁹-THC (2.5 µM) and CBD (2.0 µM) to inhibit pERK were also studied and compared to the combination treatment (Figure 2 supplementary). Again, the combination treatment produced a substantial down regulation of pERK. However, the higher concentration of Δ⁹-THC alone had no effect on pERK. The higher concentration of CBD produced only a small inhibition of pERK. Taken together, this data suggests that a unique pathway was activated by the combined administration of Δ⁹-THC and CBD, which led to the down-regulation of pERK.

Cannabinoid mediates apoptosis through p8 and caspases

The induction of the stress associated gene, p8, has been shown to be a specific event in THC-induced apoptosis, but its involvement in CBD induced apoptosis has not been determined (35, 36). This pathway was evaluated to determine the role p8 played in the observed increase in apoptosis during cannabinoid treatments (Figure 5A and B). Treatment of U251 cells with CBD lead to a small reduction in p8 expression compared to control, however, this change was not statistically significant (n=4). Treatment with Δ⁹-THC alone or the combination of Δ⁹-THC and CBD led to an up-regulation of p8 expression. The magnitude of the effect was similar between treatment groups. This data demonstrates the modulation of p8 was not specific for the combination treatment.

Figure 5

When combined, Δ⁹-THC and CBD produce an increase in activation of p8 and multiple caspases

Multiple caspase pathways were next evaluated to determine additional mechanisms by which the combination treatment increased apoptosis (Figure 5C). In the presence of CBD alone, no significant changes in caspase activity were observed. Small increases in the activity of caspase 7, caspase 9 and PARP, but not caspase 3, were observed when U251 cells were treated with the Δ⁹-THC alone. Treatment with the combination of Δ⁹-THC and CBD led to a substantial up-regulation of caspase 3, 7, and 9 activities as well as an increase in PARP expression. These data demonstrate that a unique modulation of caspase activity is produced when glioblastoma cells are treated with the combination of Δ⁹-THC and CBD as opposed to the individual cannabinoids.

1

2

3

This work was supported by the National Institutes of Health (grants CA102412 and DA09978), and the SETH Group.

CB

cannabinoid

CBD

cannabidiol

CBG

cannabigerol

CBN

cannabinol

Δ⁹-THC

Δ⁹-tetrahydrocannabinol

ERK

extracellular signal regulated kinases

ROS

reactive oxygen species